Top » Catalog » SNPs » Z17394

$18.00

Z17394
[Z17394]

Z17394
hg38 Position: ChrY:14994400..14994400
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: G2a2b2a1a1b1a1b2b1
Comments: Below Z16770
Forward Primer: Z17394_F CCAAAGGTACCATGCAGAGAG
Reverse Primer: Z17394_R CATACCAATACACCTAGCTATTCTCTCTC
Reviews

Customers who bought this product also purchased
Z41653
Z41653
Z41650
Z41650
Z27567
Z27567
S2808
S2808
Z726
Z726
G2a-L497 Panel
G2a-L497 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies