Top » Catalog » SNPs » Z253

$18.00

Z253
[Z253]

Z253
hg38 Position: ChrY:7324993..7324993
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2c1f
Comments: approx. downstream of R-L21
Forward Primer: Z253_F CACTCACAGAGCAACACCAG
Reverse Primer: Z253_R TGGGTGCAGACAGATACTACAAC
Reviews

Customers who bought this product also purchased
A178
A178
CTS2457
CTS2457
A2121
A2121
A194
A194
BY23383
BY23383
FGC11304
FGC11304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies