Top » Catalog » SNPs » Z253

$18.00

Z253
[Z253]

Z253
hg38 Position: ChrY:7324993..7324993
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2c1f
Comments: approx. downstream of R-L21
Forward Primer: Z253_F CACTCACAGAGCAACACCAG
Reverse Primer: Z253_R TGGGTGCAGACAGATACTACAAC
Reviews

Customers who bought this product also purchased
L159.2
L159.2
Y22342
Y22342
M269
M269
A5411
A5411
FGC41901
FGC41901
Z2195
Z2195
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies