Top » Catalog » SNPs » Z253

$18.00

Z253
[Z253]

Z253
hg38 Position: ChrY:7324993..7324993
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2c1f
Comments: approx. downstream of R-L21
Forward Primer: Z253_F CACTCACAGAGCAACACCAG
Reverse Primer: Z253_R TGGGTGCAGACAGATACTACAAC
Reviews

Customers who bought this product also purchased
A10499
A10499
S1090
S1090
BY203693
BY203693
S1105
S1105
FGC14590
FGC14590
Z29644
Z29644
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies