Top » Catalog » SNPs » Z17107

$18.00

Z17107
[Z17107]

Z17107
hg38 Position: ChrY:16275465..16275465
Ancestral: C
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Z5017 > S26015
Forward Primer: Z17107_F GTCTTAACTCTCTCCCTGCTAAATC
Reverse Primer: Z17107_R AGATGGTATTCGTGTTTACAGAGG
Reviews

Customers who bought this product also purchased
Y161799
Y161799
Y97307
Y97307
BY4600
BY4600
SK888
SK888
BY4455
BY4455
Y161798
Y161798
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies