Top » Catalog » SNPs » FGC90361

$18.00

FGC90361
[FGC90361]

FGC90361
hg38 Position: ChrY:12955818..12955818
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2019)
ISOGG Haplogroup: J1
Comments: Below FGC1695 > ZS5340 > FT229949
Forward Primer: FGC90361_F GGGAGAAACTTATTTTCCAAATTACAG
Reverse Primer: FGC90361_R ACTGTTTCTTAGTCTGAGGTAGTTGGAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies