Top » Catalog » SNPs » L241

$18.00

L241
[L241]

L241
hg38 Position: ChrY:5061646..5061646
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1a1b1a4
Comments: Found in a hg E-V13 person
Forward Primer: L241_F GGGGAAATTAGTTTATATAATGATGTTACG
Reverse Primer: L241_R CTAACCCCAGATCGCAAAAC
Reviews

Customers who bought this product also purchased
Z825
Z825
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M253
M253
M215
M215
M201
M201
E Superclade Panel
E Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies