Top » Catalog » SNPs » L241

$18.00

L241
[L241]

L241
hg38 Position: ChrY:5061646..5061646
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1a1b1a4
Comments: Found in a hg E-V13 person
Forward Primer: L241_F GGGGAAATTAGTTTATATAATGATGTTACG
Reverse Primer: L241_R CTAACCCCAGATCGCAAAAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY5677
BY5677
Y111832
Y111832
Y16729
Y16729
Y33582
Y33582
ZS7594
ZS7594
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies