Top » Catalog » SNPs » L241

$18.00

L241
[L241]

L241
hg38 Position: ChrY:5061646..5061646
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1a1b1a4
Comments: Found in a hg E-V13 person
Forward Primer: L241_F GGGGAAATTAGTTTATATAATGATGTTACG
Reverse Primer: L241_R CTAACCCCAGATCGCAAAAC
Reviews

Customers who bought this product also purchased
FT180614
FT180614
BY5650
BY5650
FTB75387
FTB75387
BY110010
BY110010
BY193951
BY193951
Z21367
Z21367
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies