Top » Catalog » SNPs » CTS1751

$18.00

CTS1751
[CTS1751]

CTS1751
hg38 Position: ChrY:11927905..11927905
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1d
Comments: Downstream of DF13
Forward Primer: CTS1751_F ATGTTAGCTGGGCATGATGG
Reverse Primer: CTS1751_R GACCCACCCACTACCATGAG
Reviews

Customers who bought this product also purchased
FGC42169
FGC42169
FGC30631
FGC30631
BY11922
BY11922
FGC33571
FGC33571
M343
M343
FGC29517
FGC29517
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies