Top » Catalog » SNPs » CTS1751

$18.00

CTS1751
[CTS1751]

CTS1751
hg38 Position: ChrY:11927905..11927905
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1d
Comments: Downstream of DF13
Forward Primer: CTS1751_F ATGTTAGCTGGGCATGATGG
Reverse Primer: CTS1751_R GACCCACCCACTACCATGAG
Reviews

Customers who bought this product also purchased
DF27
DF27
Y18437
Y18437
R1b-DF27 Panel
R1b-DF27 Panel
Y18513
Y18513
BY3927
BY3927
A7907
A7907
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies