Top » Catalog » SNPs » DF49

$18.00

DF49
[DF49]

DF49
hg38 Position: ChrY:20573713..20573713
Ancestral: G
Derived: A
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1a
Comments: Downstream L21; upstream of DF23
Forward Primer: DF49_F GGTAACTGACATCATAATCCAATAGC
Reverse Primer: DF49_R TCAAGGTAGTCTTCAAGATAGACAAAT
Reviews

Customers who bought this product also purchased
S1090
S1090
BY203693
BY203693
S1105
S1105
Y150210
Y150210
BY108617
BY108617
FGC32795
FGC32795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies