Top » Catalog » SNPs » DF49

$18.00

DF49
[DF49]

DF49
hg38 Position: ChrY:20573713..20573713
Ancestral: G
Derived: A
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1a
Comments: Downstream L21; upstream of DF23
Forward Primer: DF49_F GGTAACTGACATCATAATCCAATAGC
Reverse Primer: DF49_R TCAAGGTAGTCTTCAAGATAGACAAAT
Reviews

Customers who bought this product also purchased
Z367
Z367
L2
L2
L238
L238
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
DF19
DF19
Z56
Z56
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies