Top » Catalog » SNPs » DF49

$15.00

DF49
[DF49]

DF49
hg38 Position: ChrY:20573713..20573713
Ancestral: G
Derived: A
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1a
Comments: Downstream L21; upstream of DF23
Forward Primer: DF49_F GGTAACTGACATCATAATCCAATAGC
Reverse Primer: DF49_R TCAAGGTAGTCTTCAAGATAGACAAAT
Reviews

Customers who bought this product also purchased
FGC11272
FGC11272
A12386
A12386
BY23383
BY23383
FGC11304
FGC11304
FGC42169
FGC42169
FGC30631
FGC30631
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies