Top » Catalog » SNPs » DF49

$18.00

DF49
[DF49]

DF49
hg38 Position: ChrY:20573713..20573713
Ancestral: G
Derived: A
Reference: Gregory Magoon (2011)
ISOGG Haplogroup: R1b1a1a2a1a2c1a
Comments: Downstream L21; upstream of DF23
Forward Primer: DF49_F GGTAACTGACATCATAATCCAATAGC
Reverse Primer: DF49_R TCAAGGTAGTCTTCAAGATAGACAAAT
Reviews

Customers who bought this product also purchased
FGC20797
FGC20797
A13152
A13152
ZP179
ZP179
Z2195
Z2195
BY13693
BY13693
A10499
A10499
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies