Top » Catalog » SNPs » FGC13261

$18.00

FGC13261
[FGC13261]

FGC13261
hg38 Position: ChrY:12328278..12328278
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b1b4e1a
Comments: .
Forward Primer: FGC13261_F TCCACGGCTTATTCTCAACAG
Reverse Primer: FGC13261_R CCATTCCTGCCCTGATCTC
Reviews

Customers who bought this product also purchased
A689
A689
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies