Top » Catalog » SNPs » Y183077

$18.00

Y183077
[Y183077]

Y183077
hg38 Position: ChrY:14616567..14616567
Ancestral: T
Derived: A
Reference: YFull (2019)
ISOGG Haplogroup: E1b
Comments: Below M81 > MZ88
Forward Primer: Y183077_F GTCTTTATCTCTTTCAATTCTGCTTG
Reverse Primer: Y183077_R CTACACTCCAAATCAACAAAATGTCT
Reviews

Customers who bought this product also purchased
PF2546
PF2546
BY10126
BY10126
Y22558
Y22558
MZ247
MZ247
E1b-L19 Panel
E1b-L19 Panel
A2227
A2227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies