Top » Catalog » SNPs » Y183077

$18.00

Y183077
[Y183077]

Y183077
hg38 Position: ChrY:14616567..14616567
Ancestral: T
Derived: A
Reference: YFull (2019)
ISOGG Haplogroup: E1b
Comments: Below M81 > MZ88
Forward Primer: Y183077_F GTCTTTATCTCTTTCAATTCTGCTTG
Reverse Primer: Y183077_R CTACACTCCAAATCAACAAAATGTCT
Reviews

Customers who bought this product also purchased
BY10126
BY10126
PF2546
PF2546
Y141584
Y141584
M81
M81
Y22558
Y22558
MZ247
MZ247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies