Top » Catalog » SNPs » BY4684

$18.00

BY4684
[BY4684]

BY4684
hg38 Position: ChrY:13249977..13249977
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Aka Y18556. Below V13 > Z5017
Forward Primer: BY4684_F GCACTGTGTCCAGTTGCTTG
Reverse Primer: BY4684_R CCCCATCTCTACTAAAAATACAAAATTG
Reviews

Customers who bought this product also purchased
Z16988
Z16988
BY4642
BY4642
S26015
S26015
FGC71977
FGC71977
CTS5856
CTS5856
Z19851
Z19851
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies