Top » Catalog » SNPs » BY4684

$18.00

BY4684
[BY4684]

BY4684
hg38 Position: ChrY:13249977..13249977
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Aka Y18556. Below V13 > Z5017
Forward Primer: BY4684_F GCACTGTGTCCAGTTGCTTG
Reverse Primer: BY4684_R CCCCATCTCTACTAAAAATACAAAATTG
Reviews

Customers who bought this product also purchased
Z5018
Z5018
Z5016
Z5016
Y16729
Y16729
Z5017
Z5017
E1b-V13 Panel
E1b-V13 Panel
Z16988
Z16988
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies