Top » Catalog » SNPs » L200

$18.00

L200
[L200]

L200
hg38 Position: ChrY:10171274..10171274
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a
Comments: found in a R-L48* person
Forward Primer: L200v2_F TTGAGCTGTGGAAAGGAGAAG
Reverse Primer: L200v2_R CTGTCTGCTGCTCATGCGT
Reviews

Customers who bought this product also purchased
U106
U106
S5940
S5940
BY18056
BY18056
CTS3104
CTS3104
Y83097
Y83097
S268
S268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies