Top » Catalog » SNPs » L200

$18.00

L200
[L200]

L200
hg38 Position: ChrY:10171274..10171274
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a
Comments: found in a R-L48* person
Forward Primer: L200v2_F TTGAGCTGTGGAAAGGAGAAG
Reverse Primer: L200v2_R CTGTCTGCTGCTCATGCGT
Reviews

Customers who bought this product also purchased
S268
S268
S170
S170
S511
S511
U106
U106
CTS3104
CTS3104
DYS19
DYS19
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies