Top » Catalog » SNPs » L200

$18.00

L200
[L200]

L200
hg38 Position: ChrY:10171274..10171274
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a
Comments: found in a R-L48* person
Forward Primer: L200v2_F TTGAGCTGTGGAAAGGAGAAG
Reverse Primer: L200v2_R CTGTCTGCTGCTCATGCGT
Reviews

Customers who bought this product also purchased
DYS19
DYS19
DYS447
DYS447
DYS392
DYS392
DYS389I+II
DYS389I+II
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies