Top » Catalog » SNPs » L200

$18.00

L200
[L200]

L200
hg38 Position: ChrY:10171274..10171274
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a
Comments: found in a R-L48* person
Forward Primer: L200v2_F TTGAGCTGTGGAAAGGAGAAG
Reverse Primer: L200v2_R CTGTCTGCTGCTCATGCGT
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY113965
BY113965
A5333
A5333
A5317
A5317
A765
A765
S162
S162
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies