Top » Catalog » SNPs » FGC79182

$18.00

FGC79182
[FGC79182]

FGC79182
hg38 Position: ChrY:10920077..10920077
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC79182_F TTACATATCTCTCTGCACGGAGC
Reverse Primer: FGC79182_R CAGTACAGAAATATGCCACAATGC
Reviews

Customers who bought this product also purchased
S11601
S11601
BY114278
BY114278
Z381
Z381
DF95
DF95
A6915
A6915
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies