Top » Catalog » SNPs » FGC79182

$18.00

FGC79182
[FGC79182]

FGC79182
hg38 Position: ChrY:10920077..10920077
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC79182_F TTACATATCTCTCTGCACGGAGC
Reverse Primer: FGC79182_R CAGTACAGAAATATGCCACAATGC
Reviews

Customers who bought this product also purchased
L257
L257
S7047
S7047
A6924
A6924
Z372
Z372
FGC5797
FGC5797
S8402
S8402
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies