Top » Catalog » SNPs » BY154070

$18.00

BY154070
[BY154070]

BY154070
hg38 Position: ChrY:14142595..14142595
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY154070_F GAACCAAAATAAGCAACCAATTG
Reverse Primer: BY154070_R ATCATGGCCCTGACATAAGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies