Top » Catalog » SNPs » FGC11

$18.00

FGC11
[FGC11]

FGC11
hg38 Position: ChrY:16470001..16470001
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1
Comments: Downstream from J1-L858*
Forward Primer: FGC11v2_F AGGAAGATCACTTGAGGTGAGG
Reverse Primer: FGC11v2_R CAAACAAATGAAACCCAGTCC
Reviews

Customers who bought this product also purchased
CTS11741
CTS11741
ZS2518
ZS2518
ZS5973
ZS5973
SK1296
SK1296
BY115138
BY115138
ZS5964
ZS5964
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies