Top » Catalog » SNPs » FGC11

$18.00

FGC11
[FGC11]

FGC11
HG19 Position: ChrY:16470001..16470001
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1
Comments: Downstream from J1-L858*
Forward Primer: FGC11v2_F AGGAAGATCACTTGAGGTGAGG
Reverse Primer: FGC11v2_R CAAACAAATGAAACCCAGTCC
Reviews

Customers who bought this product also purchased
FGC4492
FGC4492
FGC5419
FGC5419
Z18219
Z18219
FGC4474
FGC4474
BY145
BY145
FGC5441
FGC5441
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies