Top » Catalog » SNPs » FGC11

$18.00

FGC11
[FGC11]

FGC11
hg38 Position: ChrY:16470001..16470001
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1
Comments: Downstream from J1-L858*
Forward Primer: FGC11v2_F AGGAAGATCACTTGAGGTGAGG
Reverse Primer: FGC11v2_R CAAACAAATGAAACCCAGTCC
Reviews

Customers who bought this product also purchased
FGC19543
FGC19543
Y4348
Y4348
FGC15940
FGC15940
Z2345
Z2345
PF7264
PF7264
ZS9878
ZS9878
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies