Top » Catalog » SNPs » FGC11

$18.00

FGC11
[FGC11]

FGC11
hg38 Position: ChrY:16470001..16470001
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1
Comments: Downstream from J1-L858*
Forward Primer: FGC11v2_F AGGAAGATCACTTGAGGTGAGG
Reverse Primer: FGC11v2_R CAAACAAATGAAACCCAGTCC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
FGC5235
FGC5235
DYS459
DYS459
FGC5230
FGC5230
L174
L174
DYS454
DYS454
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies