Top » Catalog » SNPs » FTA23388

$18.00

FTA23388
[FTA23388]

FTA23388
hg38 Position: ChrY:12162138..12162138
Ancestral: T
Derived: G
Reference: FTDNA (2021)
ISOGG Haplogroup: I2
Comments: Below A20217
Forward Primer: FTA23388_F TGCTGCTAAAGACATAGCTGAGC
Reverse Primer: FTA23388_R CTGCTTACTTATGTGACATTGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies