Top » Catalog » SNPs » FTA19321

$18.00

FTA19321
[FTA19321]

FTA19321
hg38 Position: ChrY:15110052..15110052
Ancestral: T
Derived: C
Reference: FTDNA (2021)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FTA19321_F TCTGTCAACTCGTCAAACTCAAC
Reverse Primer: FTA19321_R GCCTGACAGCACTGAAGAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies