Top » Catalog » SNPs » Y56049

$18.00

Y56049
[Y56049]

Y56049
hg38 Position: ChrY:17433178..17433178
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y56049_F TTGAGGTTGTTGGAGTCTGACTC
Reverse Primer: Y56049_R ACTTGGGAAAACTCTACCACTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies