Top » Catalog » SNPs » Y5383

$19.00

Y5383
[Y5383]

Y5383
hg38 Position: ChrY:8534884..8534884
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y5383_F GAATGTCACCATTGCCTTACAAC
Reverse Primer: Y5383_R AGAGGTGATTTGGATGATGGAG
Reviews

Customers who bought this product also purchased
L2
L2
FGC57691
FGC57691
Y4355
Y4355
FGC57704
FGC57704
Z142
Z142
FGC57689
FGC57689
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies