Top » Catalog » SNPs » Y5383

$18.00

Y5383
[Y5383]

Y5383
hg38 Position: ChrY:8534884..8534884
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y5383_F GAATGTCACCATTGCCTTACAAC
Reverse Primer: Y5383_R AGAGGTGATTTGGATGATGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies