Top » Catalog » SNPs » Y46815

$18.00

Y46815
[Y46815]

Y46815
hg38 Position: ChrY:8220048..8220048
Ancestral: A
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: E
Comments: Below M84 > Y5427 > Z36149 > BY20365
Forward Primer: Y46815_F GTGTACCAGTTCTTCCAAAGTTCAG
Reverse Primer: Y46815_R GGGAAGACCCCAGTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies