Top » Catalog » SNPs » FGC12

$18.00

FGC12
[FGC12]

FGC12
hg38 Position: ChrY:12045625..12045625
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream from J1-L858 and FGC11
Forward Primer: FGC12v3_F GTAACTAACCTGCACATTGTGCAC
Reverse Primer: FGC12v3_R TATCAGATTAAGGAGATTTTCGACG
Reviews

Customers who bought this product also purchased
FGC2
FGC2
DNA Sample Kit
DNA Sample Kit
ZS3292
ZS3292
ZS3290
ZS3290
FGC7393
FGC7393
CTS11741
CTS11741
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies