Top » Catalog » SNPs » FGC12

$18.00

FGC12
[FGC12]

FGC12
hg38 Position: ChrY:12045625..12045625
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream from J1-L858 and FGC11
Forward Primer: FGC12v3_F GTAACTAACCTGCACATTGTGCAC
Reverse Primer: FGC12v3_R TATCAGATTAAGGAGATTTTCGACG
Reviews

Customers who bought this product also purchased
DYS454
DYS454
CDY
CDY
DYS390
DYS390
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
DYS459
DYS459
FGC5235
FGC5235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies