Top » Catalog » SNPs » FGC12

$18.00

FGC12
[FGC12]

FGC12
hg38 Position: ChrY:12045625..12045625
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream from J1-L858 and FGC11
Forward Primer: FGC12v3_F GTAACTAACCTGCACATTGTGCAC
Reverse Primer: FGC12v3_R TATCAGATTAAGGAGATTTTCGACG
Reviews

Customers who bought this product also purchased
L862
L862
FGC4737
FGC4737
FGC5
FGC5
FGC4745
FGC4745
ZS241
ZS241
ZS6205
ZS6205
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies