Top » Catalog » SNPs » FT156373

$18.00

FT156373
[FT156373]

FT156373
hg38 Position: ChrY:6645098..6645098
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT156373_F CTATTGCCCCCTCCTTTCAG
Reverse Primer: FT156373_R GGATAAATTGCCCCATAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies