Top » Catalog » SNPs » FGC66972

$18.00

FGC66972
[FGC66972]

FGC66972
hg38 Position: ChrY:13434928..13434928
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC66972_F AAGAAATTTACCTTACATGGAAAGGTTC
Reverse Primer: FGC66972_R TTATATGTAGTTGTATAGTTTCCAGCATTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies