Top » Catalog » SNPs » FT13988

$18.00

FT13988
[FT13988]

FT13988
hg38 Position: ChrY:20451771..20451771
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below U106 > U198 > JFS0010 > Y62042
Forward Primer: FT13988_F CAGAGGAATGGAAGAGCACAAC
Reverse Primer: FT13988_R AAAGAGACACAGAGGTTTAATTAAACTTC
Reviews

Customers who bought this product also purchased
FT372984
FT372984
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A27522
1 x A25246
1 x A14027
1 x A24714
$72.00
Haplogroup Info
Other products
Currencies