Top » Catalog » SNPs » BY122710

$18.00

BY122710
[BY122710]

BY122710
hg38 Position: ChrY:16521125..16521125
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R
Comments: .
Forward Primer: BY122710_F GTAGGAATTATTTATATGTGTTCTTTTCATG
Reverse Primer: BY122710_R GTAATGCACAGCAAATCTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY34721
1 x FT109402
$36.00
Haplogroup Info
Other products
Currencies