Top » Catalog » SNPs » BY191636

$19.00

BY191636
[BY191636]

BY191636
hg38 Position: ChrY:18923709..18923709
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY191636_F TATTATGGTAGAATGATAAAAATAATGAACTG
Reverse Primer: BY191636_R CGGAGTCTCACTCTGGGATG
Reviews

Customers who bought this product also purchased
M9
M9
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
BY19000
BY19000
M267
M267
E1b-V13 Panel
E1b-V13 Panel
Z16242
Z16242
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies