Top » Catalog » SNPs » BY191636

$18.00

BY191636
[BY191636]

BY191636
hg38 Position: ChrY:18923709..18923709
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY191636_F TATTATGGTAGAATGATAAAAATAATGAACTG
Reverse Primer: BY191636_R CGGAGTCTCACTCTGGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY34721
1 x FT109402
$36.00
Haplogroup Info
Other products
Currencies