Top » Catalog » SNPs » FT367304

$18.00

FT367304
[FT367304]

FT367304
hg38 Position: ChrY:16975497..16975497
Ancestral: C
Derived: A
Reference: FTDNA (2020)
ISOGG Haplogroup: E
Comments: .
Forward Primer: FT367304_F CCTTGAGTAGAAGTTGAGTACCAAGG
Reverse Primer: FT367304_R CTGACCAAGTGCATCATCTAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies