Top » Catalog » SNPs » FTA32571

$18.00

FTA32571
[FTA32571]

FTA32571
hg38 Position: ChrY:18948247..18948247
Ancestral: G
Derived: A
Reference: FTDNA (2021)
ISOGG Haplogroup: R1b
Comments: Below DF90 > FGC59581 > Y144492
Forward Primer: FTA32571_F CTGAGAGGTAGTGGAGGGCA
Reverse Primer: FTA32571_R GGTTGGGCAGAATTTCTAGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies