Top » Catalog » SNPs » FTA34922

$18.00

FTA34922
[FTA34922]

FTA34922
hg38 Position: ChrY:6196111..6196111
Ancestral: C
Derived: T
Reference: FTDNA (2021)
ISOGG Haplogroup: R1b
Comments: Below DF90 > FGC59581 > Y144492
Forward Primer: FTA34922_F CAGTGCCTCACTCCCAGTTC
Reverse Primer: FTA34922_R ATCTCCCTCTAAAATCAAGGAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies