Top » Catalog » SNPs » BY34721

$18.00

BY34721
[BY34721]

BY34721
hg38 Position: ChrY:15699385..15699385
Ancestral: A
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below FGC11134 > A114 > A541 > A159 > BY21825
Forward Primer: BY34721_F ACGTTCTCTCATATCCTATTAAAAGACA
Reverse Primer: BY34721_R TCAAAGATTTCATGCCAAGATTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY34721
1 x FT109402
$36.00
Haplogroup Info
Other products
Currencies