Top » Catalog » SNPs » Y127792

$18.00

Y127792
[Y127792]

Y127792
hg38 Position: ChrY:22260953..22260953
Ancestral: C
Derived: A
Reference: YFull (2021)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y127792_F TGGGATTTTTCCTCATTTTCC
Reverse Primer: Y127792_R GGCCACTAAATCTGACATTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FTA7347
$18.00
Haplogroup Info
Other products
Currencies