Top » Catalog » SNPs » BY108126

$18.00

BY108126
[BY108126]

BY108126
hg38 Position: ChrY:14372032..14372032
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: BY108126_F AGAACAGAAGTGAAATTCTTGAAGC
Reverse Primer: BY108126_R CCATGACACACATTTTCCTATGTAAG
Reviews

Customers who bought this product also purchased
BY71464
BY71464
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies